Aev_g11126 (WAK5)


Aliases : WAK5

Description : EC_2.7 transferase transferring phosphorus-containing group & original description: none


Gene families : OG0000294 (OrthoFinder output from all 47 species) Phylogenetic Tree(s): OG0000294_tree

Sequence : coding (download), protein (download)


Attention: This gene has low abundance.


Note:Only the main profile, including all conditions, is shown. Additional statistics and tissue specific profiles are available here.


Type Description Actions
Neighborhood HRR: Aev_g11126

Target Alias Description ECC score Gene Family Method Actions
Aop_g67964 No alias EC_2.7 transferase transferring phosphorus-containing... 0.02 OrthoFinder output from all 47 species
ChrUn.fgenesh.mRNA.57 WAK5 protein kinase (WAK/WAKL) 0.07 OrthoFinder output from all 47 species
Dde_g49985 No alias not classified & original description: none 0.04 OrthoFinder output from all 47 species
GSVIVT01026125001 WAK5 Protein modification.phosphorylation.TKL kinase... 0.02 OrthoFinder output from all 47 species
LOC_Os01g26210.1 WAK5, LOC_Os01g26210 protein kinase (WAK/WAKL) 0.01 OrthoFinder output from all 47 species
LOC_Os09g30454.1 WAK2, LOC_Os09g30454 protein kinase (WAK/WAKL) 0.02 OrthoFinder output from all 47 species
Nbi_g40149 WAK4 EC_2.7 transferase transferring phosphorus-containing... 0.02 OrthoFinder output from all 47 species
Spa_g20466 No alias not classified & original description: none 0.03 OrthoFinder output from all 47 species
Zm00001e016175_P002 WAK3, Zm00001e016175 protein kinase (WAK/WAKL) 0.01 OrthoFinder output from all 47 species
Zm00001e036387_P001 WAK2, Zm00001e036387 protein kinase (WAK/WAKL) 0.01 OrthoFinder output from all 47 species

ATTTTACAGCGGTTCTATCTTGGACAACGCAGCCCGGAATCGGACCATGTTGCACTTCATGTTGTGTTGGCTGTAAATTATGCGGTACCGTTGCAGTTAGAACATGAAGTTCCTCTCGATTATCGGGTTGATGCTAATAAAAGAGAGCGGTATTCAGCGGGGTTGCTGGCTGCACTTTTTCCCCCTACAGGGACATGGGAAACTCTTCAAAGATGCTTGCTAAATGTGGTACAACAGGTGTTTGGGGCAAAGAAGGTTCAAAGGCAACAGAAAGGGCTGCCACAAAAGAGGTGGTTTGATGACGAATGCAAAAAGGCCCGCATACATGTT
Type GO Term Name Evidence Source
MF GO:0004672 protein kinase activity IEA Interproscan
MF GO:0005524 ATP binding IEA Interproscan
BP GO:0006468 protein phosphorylation IEA Interproscan
Type GO Term Name Evidence Source
BP GO:0009719 response to endogenous stimulus IEP HCCA
BP GO:0009725 response to hormone IEP HCCA
BP GO:0009733 response to auxin IEP HCCA
BP GO:0010033 response to organic substance IEP HCCA
BP GO:0042221 response to chemical IEP HCCA
BP GO:0050896 response to stimulus IEP HCCA
InterPro domains Description Start Stop
IPR000719 Prot_kinase_dom 425 698
No external refs found!