Aev_g11126 (WAK5)

Aliases : WAK5

Description : EC_2.7 transferase transferring phosphorus-containing group & original description: none

Gene families : OG0000294 (OrthoFinder output from all 47 species) Phylogenetic Tree(s): OG0000294_tree

Sequence : coding (download), protein (download)

Attention: This gene has low abundance.

Note:Only the main profile, including all conditions, is shown. Additional statistics and tissue specific profiles are available here.

Type	Description	Actions
Neighborhood	HRR: Aev_g11126

Target	Alias	Description	ECC score	Gene Family Method
Aop_g67964	No alias	EC_2.7 transferase transferring phosphorus-containing...	0.02	OrthoFinder output from all 47 species
ChrUn.fgenesh.mRNA.57	WAK5	protein kinase (WAK/WAKL)	0.07	OrthoFinder output from all 47 species
Dde_g49985	No alias	not classified & original description: none	0.04	OrthoFinder output from all 47 species
GSVIVT01026125001	WAK5	Protein modification.phosphorylation.TKL kinase...	0.02	OrthoFinder output from all 47 species
LOC_Os01g26210.1	WAK5, LOC_Os01g26210	protein kinase (WAK/WAKL)	0.01	OrthoFinder output from all 47 species
LOC_Os09g30454.1	WAK2, LOC_Os09g30454	protein kinase (WAK/WAKL)	0.02	OrthoFinder output from all 47 species
Nbi_g40149	WAK4	EC_2.7 transferase transferring phosphorus-containing...	0.02	OrthoFinder output from all 47 species
Spa_g20466	No alias	not classified & original description: none	0.03	OrthoFinder output from all 47 species
Zm00001e016175_P002	WAK3, Zm00001e016175	protein kinase (WAK/WAKL)	0.01	OrthoFinder output from all 47 species
Zm00001e036387_P001	WAK2, Zm00001e036387	protein kinase (WAK/WAKL)	0.01	OrthoFinder output from all 47 species

ATTTTACAGCGGTTCTATCTTGGACAACGCAGCCCGGAATCGGACCATGTTGCACTTCATGTTGTGTTGGCTGTAAATTATGCGGTACCGTTGCAGTTAGAACATGAAGTTCCTCTCGATTATCGGGTTGATGCTAATAAAAGAGAGCGGTATTCAGCGGGGTTGCTGGCTGCACTTTTTCCCCCTACAGGGACATGGGAAACTCTTCAAAGATGCTTGCTAAATGTGGTACAACAGGTGTTTGGGGCAAAGAAGGTTCAAAGGCAACAGAAAGGGCTGCCACAAAAGAGGTGGTTTGATGACGAATGCAAAAAGGCCCGCATACATGTT

Type	GO Term	Name	Evidence	Source
MF	GO:0000166	nucleotide binding	None	Extended
MF	GO:0003674	molecular_function	None	Extended
MF	GO:0003824	catalytic activity	None	Extended
MF	GO:0004672	protein kinase activity	IEA	Interproscan
MF	GO:0005488	binding	None	Extended
MF	GO:0005524	ATP binding	IEA	Interproscan
BP	GO:0006468	protein phosphorylation	IEA	Interproscan
BP	GO:0006793	phosphorus metabolic process	None	Extended
BP	GO:0006796	phosphate-containing compound metabolic process	None	Extended
BP	GO:0006807	nitrogen compound metabolic process	None	Extended
BP	GO:0008150	biological_process	None	Extended
BP	GO:0008152	metabolic process	None	Extended
BP	GO:0009987	cellular process	None	Extended
MF	GO:0016301	kinase activity	None	Extended
BP	GO:0016310	phosphorylation	None	Extended
MF	GO:0016740	transferase activity	None	Extended
MF	GO:0016772	transferase activity, transferring phosphorus-containing groups	None	Extended
MF	GO:0016773	phosphotransferase activity, alcohol group as acceptor	None	Extended
MF	GO:0017076	purine nucleotide binding	None	Extended
BP	GO:0019538	protein metabolic process	None	Extended
MF	GO:0030554	adenyl nucleotide binding	None	Extended
MF	GO:0032553	ribonucleotide binding	None	Extended
MF	GO:0032555	purine ribonucleotide binding	None	Extended
MF	GO:0032559	adenyl ribonucleotide binding	None	Extended
MF	GO:0035639	purine ribonucleoside triphosphate binding	None	Extended
MF	GO:0036094	small molecule binding	None	Extended
BP	GO:0036211	protein modification process	None	Extended
MF	GO:0043167	ion binding	None	Extended
MF	GO:0043168	anion binding	None	Extended
BP	GO:0043170	macromolecule metabolic process	None	Extended
BP	GO:0043412	macromolecule modification	None	Extended
BP	GO:0044237	cellular metabolic process	None	Extended
BP	GO:0044238	primary metabolic process	None	Extended
BP	GO:0071704	organic substance metabolic process	None	Extended
MF	GO:0097159	organic cyclic compound binding	None	Extended
MF	GO:0097367	carbohydrate derivative binding	None	Extended
MF	GO:0140096	catalytic activity, acting on a protein	None	Extended
MF	GO:1901265	nucleoside phosphate binding	None	Extended
MF	GO:1901363	heterocyclic compound binding	None	Extended
BP	GO:1901564	organonitrogen compound metabolic process	None	Extended

Toggle parental

Type	GO Term	Name	Evidence	Source
BP	GO:0009719	response to endogenous stimulus	IEP	HCCA
BP	GO:0009725	response to hormone	IEP	HCCA
BP	GO:0009733	response to auxin	IEP	HCCA
BP	GO:0010033	response to organic substance	IEP	HCCA
BP	GO:0042221	response to chemical	IEP	HCCA
BP	GO:0050896	response to stimulus	IEP	HCCA

InterPro domains	Description	Start	Stop
IPR000719	Prot_kinase_dom	425	698

External Links

No external refs found!

Aev_g11126 (WAK5)

Expression Profile

Co-expression Networks

Expression Context Conservation (ECC)

Functional Annotation